Adding sequence tags to sequencing adapters

We provide an extremely simple program for integrating sequence tags, output by design_edit_metric_sequence_tags.py, to sequencing adapters. This program is largely meant for cases where you need to consistently add many sequence tags to a single adapter. The program is invoked as follows and output is sent to stdout:

python add_tags_to_adapters.py \
    --input=test-data/edit_metric_tags.conf
    --5prime=CAAGCAGAAGACGGCATACGAGA
    --3prime=TGACTGGAGTTC \
    --section='5nt ed3'

Options

--input=<FILE>
	The input file to check. The format must follow guidelines in Input file formatting.
--5-prime=<string>
	The adapter sequence 5’ of the sequence tag.
--3-prime=<string>
	The adapter sequence 3’ of the sequence tag.
--section=<string>
	The section of tags to apply to the adapter sequence. Used when an input file contains many sections of tags, and you only want to check one. When the input file contains multiple sections, and you do not pass this option, the program will output adapters with all the sequence tags in
--revcomp
	Add the reverse complement of the sequence tag rather than the forward complement.
--suppress-orientation
	Suppress pretty printing of the results to stdout and just return the adapter sequences.

Output

Results written to stdout have the following appearance. Notice that the integrated tag sequence is converted to lower-case:

[4nt ed3]
    5' - AAAAgtcaGGGG - 3'
    5' - AAAAaaccGGGG - 3'
    5' - AAAAacagGGGG - 3'
    5' - AAAAaggaGGGG - 3'
    5' - AAAAcctaGGGG - 3'
    5' - AAAAcgatGGGG - 3'
    5' - AAAAtgtgGGGG - 3'

To write results to an output file, you can just use redirection:

python add_tags_to_adapters.py \
        --input=test-data/edit_metric_tags.conf
        --5prime=CAAGCAGAAGACGGCATACGAGA
        --3prime=TGACTGGAGTTC \
        --section='5nt ed3' > my_output_file.txt